| dc.creator |
ANUNCIAÇÃO CARLOS EDUARDO |
|
| dc.creator |
ASTOLFI-FILHO SPARTACO |
|
| dc.date |
2000 |
|
| dc.date.accessioned |
2013-05-30T01:56:38Z |
|
| dc.date.available |
2013-05-30T01:56:38Z |
|
| dc.date.issued |
2013-05-30 |
|
| dc.identifier |
http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2000001000012 |
|
| dc.identifier |
http://www.doaj.org/doaj?func=openurl&genre=article&issn=0100204X&date=2000&volume=35&issue=10&spage=2007 |
|
| dc.identifier.uri |
http://koha.mediu.edu.my:8181/jspui/handle/123456789/3447 |
|
| dc.description |
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively. |
|
| dc.publisher |
Empresa Brasileira de Pesquisa Agropecuária (Embrapa) |
|
| dc.source |
Pesquisa Agropecuária Brasileira |
|
| dc.subject |
breeding methods |
|
| dc.subject |
molecular cloning |
|
| dc.subject |
progeny testing |
|
| dc.subject |
horses |
|
| dc.subject |
identification |
|
| dc.subject |
genetic polymorphism |
|
| dc.title |
Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting |
|